Huyết Học-Truyền Máu-Miễn Dịch-Sinh Học Phân Tử Phần 5

Thứ năm - 10/09/2015 02:24
Hemophilia A là một bệnh rối loạn đông máu , nguyên nhân là do các đột biến trên gen mã hóa yếu tố VIII. Khoảng 50% người bệnh hemophilia A thể nặng là do đảo đoạn intron 22 của gen yếu tốVIII. Đảo đoạn này xuất hiện do sự tái tổ hợp giữa vùng 5’ của gen yếu tố...
PHÁT HIỆN ĐẢO ĐOẠN INTRON 22 CỦA GEN YẾU TỐ VIII BỆNH HEMOPHILIA BẰNG KỸ THUẬT LONG-RANGE PCR
DETECTION OF INTRON 22 INVERSION OF FACTOR VIII GENE IN
HEMOPHILIA BY LONG-RANGE PCR
 
 I. NGUYÊN LÝ
Hemophilia A là một bệnh rối loạn đông máu , nguyên nhân là do các đột biến trên gen mã hóa yếu tố VIII. Khoảng 50% người bệnh hemophilia A thể nặng là do đảo đoạn intron 22 của gen yếu tốVIII. Đảo đoạn này xuất hiện do sự tái tổ hợp giữa vùng 5’ của gen yếu tố VIII (int22h1) với vùng lặp lại (vùng tương đồng) ở phần cuối cùng trên cánh dài của NST X (int22h2 (proximal) hoặc int22h3 (distal)). Kỹ thuật Longrange PCR với sự kết hợp của hai loại enzym: enzym đọc sửa và enzym có hoạt tính tổng hợp đoạn ADN lớn cho phép khuếch đại các vùng ADN tái tổ hợp này tạo ra sản phẩm PCR có kích thước 10-
12kb. Sản phẩm PCR này được phát hiện khi điện di trên agarose và đọc trên hệ thống đọc gel.
II. CHỈ ĐỊNH
Xét nghiệm này chỉ định cho tất cả các người bệnh mắc bệnh Hemophilia
A thể nặng.
 
III. CHỐNG CHỈ ĐỊNH
Không có chống chỉ định.
 
IV. CHUẨN BỊ
1. Ngƣời thực hiện
- Kỹ thuật viên xét nghiệm sinh học phân tử đã được đào tạo
 
2. Phƣơng tiện - Hóa chất
 
2.1. Phương tiện
- Máy PCR;
- Hệ thống máy điện di, hệ thống đèn cực tím soi gel, hệ thống máy chụp ảnh;
- Buồng vô trùng (biology cabinet);
- Máy ly tâm tốc độ cao (tốc độ tối đa 14.000 vòng/phút);
- Máy vortex;
- Các loại pipet 10 µl, 20 µl, 100 µl, 200 µl, 1000 µl;
- Đầu côn có màng lọc;
- Ống eppendorf 1,5 ml vô trùng, không có enzym nucleaza;
- Ống PCR 0,2 ml vô trùng, không có enzym nucleaza;
- Tủ lạnh 4-8oC, tủ âm sâu -20oC;
- Găng tay.
 
2.2 Hóa chất
- Sử dụng kit tách ADN thương mại. Nếu tách thủ công thì sử dụng các sinh phẩm cần thiết để tách chiết ADN như proteinase K, đệm ly giải tế bào, phenol/chloroform, cồn tuyệt đối.
- Hóa chất chạy Longrange PCR gồm: Kit LongRange PCR, MgCl2, dNTPs, 7-deaza-dGTP, DMSO, enzym kéo dài chuỗi, nước khử ion vô trùng,
các cặp mồi đặc hiệu, theo bảng sau:
 
P 5’GCCCTGCCTGTCCATTACACTGATGACATTATGCTGAC3’(38-mer)
Q 5’GGCCCTACAACCATTCTGCCTTTCACTTTCAGTGCAATA 3’(3- mer)
A 5’CACAAGGGGGAAGAGTGTGAGGGTGTGGGATAAGAA 3’ (36-mer)
B 5’CCCCAAACTATAACCAGCACCTTGAACTTCCCCTCTCATA3’(40-
mer)
- Hóa chất điện di: thạch agarose, đệm tra mẫu, thang chuẩn ADN, thuốc
nhuộm ethidium bromide.
 
3. Bệnh phẩm
2 ml máu ngoại vi đựng trong ống chống đông EDTA.
 
4. Phiếu xét nghiệm
Có đầy đủ các thông tin cần thiết về người bệnh, về chẩn đoán và yêu cầu xét nghiệm.
V. CÁC BƢỚC TIẾN HÀNH
1. Lấy bệnh phẩm
2 ml  máu ngoại vi chống đông bằng EDTA.
 
2. Tiến hành kỹ thuật
Bƣớc 1: Tách chiết ADN
Xem bài “Tách chiết ADN từ máu ngoại vi”.
 
Bƣớc 2: Thực hiện phản ứng Long-range PCR
- Ghi tên các ống phản ứng.
- Pha 2 master mix PCR trong box vô trùng tại phòng tiền PCR theo bảng sau:
+ Master mix1 (MM1):

 
Thành phần Thể tích
dATP(10mM) 1,25μl
dCTP(10mM) 1,25μl
dTTP (10mM) 1,25μl
dGTP (10mM) 0,625μl
7-deaza-dGTP (10mM) 0,625μl
Oligo-P (10pmoles/ ) 0,5μl
Oligo-Q (10pmoles/ ) 0,5μl
Oligo-A (10pmoles/ ) 0,2μl
Oligo-B (10pmoles/ ) 0,2μl
10X buffer 2,0μl
DMSO 0,4μl
+ Master mix 2 (MM2)
 
Longrange PCR enzym mix (5UI/ μl) 0,5μl
10X longrange PCR buffer 0,5μl
Nước cất 4,0μl

 - Trộn đều các ống master mix, ly tâm nhẹ để dung dịch xuống đáy ống hoàn toàn;
 - Chia 8.8μl MM1 vào các ống PCR 0.2ml đã chuẩn bị;
- Bổ sung 10-20ng ADN mẫu và chứng cùng với  nước khử ion vô trùng cho đủ thể tích ống phản ứng là 20μl;
- Chạy PCR: Đặt ống phản ứng vào máy PCR, ấn start đợi khi máy đã chạy xong chu kỳ biến tính lần đầu ở 95οC/30s. Ấn “Pause”;
- Mở nắp ống phản ứng, bổ sung 5μl MM2 vào mỗi tube và trộn đều bằng pipet. Ấn “Resume”.
Bƣớc 3: Điện di kiểm tra sản phẩm Longrange PCR Chuẩn bị gel agarose;
- Cân 0.5 g agarose cho vào bình thủy tinh chịu nhiệt;
- Thêm 100 ml đệm điện di (TAE 1X /TBE 1X...) vào bình, lắc đều;
- Đun mỗi lần 1 phút trong lò vi sóng đến khi agarose tan hoàn toàn;
- Để ấm đến 60o rồi đổ vào khay đã cắm lược;
- Để nhiệt độ phòng 30 phút để thạch đông rồi mới rút lược ra.
 
Điện di:
- Lấy 5 µl sản phẩm PCR + 1 µl đệm tra mẫu  + 4 µl dH20;
- Trộn đều và nhỏ vào các giếng theo thứ tự;
- Nhỏ 3 µl marker ADN vào giếng kế tiếp;
- Đặt bản gel vào máy điện di;
- Đổ đệm điện di ngập bản gel và chạy ở hiệu điện thế 90volt/1giờ, kiểm tra băng, nếu có chạy tiếp ít nhất 12 giờ (có thể chạy tới 21 giờ). Nếu không thấy có băng dừng chạy làm lại phản ứng PCR;
- Nhuộm bản gel với dung dịch ethidium bromide trong 5 phút;
- Chụp ảnh gel, in ảnh và dán vào worksheet.
 
VI. NHẬN ĐỊNH KẾT QUẢ Trên hình ảnh điện di:
- Mẫu không có đảo đoạn sẽ có 02 băng ADN: 10kb, 12kb;
- Mẫu nam có đảo đoạn sẽ có 02 băng ADN: 10kb,11kb;
- Mẫu nữ có đảo đoạn dị hợp tử có 03 băng ADN: 10kb,11kb,12kb.
 
VII. NHỮNG SAI SÓT VÀ XỬ TRÍ
SAI SÓT                                                  XỬ TRÍ

§ Lấy mẫu không đủ hoặc sai chất chống đông.

· Thực hiện đúng hướng dẫn qui cách lấy mẫu.

§ Thao tác pipet không chính xác.     · Sử dụng pipet theo đúng thể tích quy định.
 
§ Tín hiệu phản ứng không rõ ràng.   · Bảo quản hóa chất đúng theo khuyến cáo của nhà sản xuất
Thực hiện đúng, đủ các bước trong quy trình xét nghiệm.
 
 
TÀI LIỆU THAM KHẢO
1. D J Bowen. Haemophilia A and Haemophilia B: molecular insights. J Clin
Pathol: Mol Pathol 2002; 55:1-8.
2. Keeney S et al. The molecular analysis of haemophilia A: a guideline from the UK Haemophilia Centre Doctors' Organization Haemophilia Genetics Laboratory Network. Haemophilia 2005; 11: 387-97.

CHƢƠNG IV. TRUYỀN MÁU (Blood Transfution)
 
 
 
XÉT NGHIỆM HÒA HỢP MIỄN DỊCH PHÁT MÁU Ở 22°C (Kỹ thuật gelcard/Scangel)
(Gelcard/ scangel technique for compatibility testing at 22°C)
 
 I. NGUYÊN LÝ
Xét nghiệm hòa hợp miễn dịch phát máu ở 22°C có nguyên lý của phản ứng ngưng kết và được sử dụng để phát hiện các kháng thể có trong huyết thanh của người nhận hoặc người cho mà các kháng thể này có khả năng gây ngưng kết trực tiếp hồng cầu của người cho hoặc người nhận trong môi trường nước muối ở 22°C và gây tan máu trong lòng mạch [1], [2], [3].
II. CHỈ ĐỊNH
Xét nghiệm hòa hợp miễn dịch phát máu ở 22°C được chỉ định trong những
 
trường hợp sau:
- Truyền máu toàn phần, khối hồng cầu còn nhiều huyết tương, khối bạch cầu;
- Truyền khối hồng cầu còn ít hoặc không còn huyết tương;
- Truyền chế phẩm tiểu cầu, huyết tương.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị
Máy ủ gelcard chuyên dụng; Máy ly tâm gelcard chuyên dụng; Máy ly tâm ống thẳng có số vòng và thời gian chính xác để ly tâm ống máu; Tủ lạnh đựng sinh phẩm…
2.2. Dụng cụ
Ống nghiệm thuỷ tinh: 12x75mm; Giá cắm ống nghiệm; Khay men hình chữ nhật:  25x30 cm; Bút marker; Pipet nhựa; Pipet tự động; Đầu côn các loại; Hộp đựng đầu côn; Giá đỡ gelcard.
2.3. Thuốc thử và hoá chất
·   Dung dịch Liss; Nước muối sinh lý 0,9%; Nước cất.

·   Tấm gelcard nước muối.
2.4. Mẫu máu để làm phản ứng hòa hợp
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
2.5. Vật tư tiêu hao
Sổ ghi kết quả; Phiếu xét nghiệm định nhóm máu; Mũ giấy; Khẩu trang; Găng
tay; Quần áo công tác.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Nhận mẫu máu và phiếu yêu cầu truyền máu, chế phẩm, kiểm tra và đối chiếu các thông tin trên mẫu máu và phiếu yêu cầu truyền máu. Kiểm tra về số lượng và chất lượng mẫu máu.
2. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm.
3. Tiến hành kỹ thuật [4]
- Bước 1: Mang dung dịch LISS được bảo quản trong tủ lạnh về nhiệt độ phòng
trước khi sử dụng;
- Bước 2: Chuẩn bị hồng cầu người cho và/hoặc người nhận 0,8% (10 µl hồng cầu khối và 1ml dung dịch LISS), dịch treo hồng cầu sau khi pha phải được sử dụng để làm xét nghiệm ngay; Ly tâm ống máu không chống đông để tách huyết thanh;
- Bước 3: Ghi nhãn vào vị trí từng cột gel trên tấm gelcard họ và tên người nhận, mã số (nếu có), số giường, khoa, phòng… và mã số, thành phần của đơn vị máu, chế phẩm.
- Bước 4: Mở tấm bảo vệ phủ trên cột gel theo đúng quy định;
- Bước 5: Nhỏ 50 µl dung dịch hồng cầu 0,8% của người cho đã được chuẩn bị ở trên vào các cột gel thích hợp đã được ghi nhãn;
- Bước 6: Thêm 25 µl huyết thanh hoặc huyết tương của người bệnh và người cho vào các cột gel tương ứng;
- Bước 7: Ủ tấm gelcard trên 15 phút ở nhiệt độ phòng;
- Bước 8: Sau ủ, ly tâm 10 phút ở máy ly tâm gelcard chuyên dụng;
- Bước 9: Lấy gelcard ra khỏi máy ly tâm;
- Bước 10: Đọc kết quả trên máy đọc gelcard và lưu giữ kết quả bằng phần mềm máy tính;
VI. NHẬN ĐỊNH KẾT QUẢ

1. Kết quả xét nghiệm hòa hợp phát máu ở 22°C âm tính
Máu của người cho và người bệnh là hòa hợp; Kết hợp với kết quả xác định nhóm hệ ABO, Rh D và kết quả xét nghiệm hòa hợp miễn dịch phát máu có sử dụng kháng globulin người để quyết định phát máu và chế phẩm cho các khoa lâm sàng để truyền cho người bệnh.
2. Kết quả xét nghiệm hòa hợp phát máu ở 22°C dƣơng tính
Máu của người cho và người bệnh là không hòa hợp; Lặp lại xét nghiệm với một đơn vị máu khác và kết hợp với kết quả xác định nhóm hệ ABO, Rh D và kết quả xét nghiệm hòa hợp miễn dịch phát máu có sử dụng kháng globulin người để quyết định có hoặc không phát máu và chế phẩm cho các khoa lâm sàng để truyền cho người bệnh.
Những điểm cần chú ý khi làm xét nghiệm
- Thực hiện kiểm chứng theo quy định của thông tư 26/ 2013/TT- BYT về
Hướng dẫn hoạt động truyền máu [5].
- Đọc kỹ và tuân thủ đúng các bước tiến hành kỹ thuật theo hướng dẫn của nhà sản xuất sinh phẩm mà hiện đơn vị đang sử dụng;
 Tài liệ u tham khả o
1.   Denise  M  Harmening  (1999)  Modern  blood  banking  and  transfusion practices, fourth edition, Book Promotion & Service Co., LTD.
2.   Đỗ Trung Phấn (2013), Kỹ thuật xét nghiệm huyết học và truyền máu ứng dụng trong lâm sàng (Tái bản lần 2), Nhà xuất bản y học năm 2013.
3.   Geoff  Daniels  and  Imelda  Bromilow  (2009),  Essential  Guide  to  Blood
Groups, Blackwell.
4.   Hướng dẫn sử dụng gelcard nước muối (Neutral Gel Card).
5.   Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

NGHIỆM PHÁP COOMBS TRỰC TIẾP
(Dirrect antiglobulin test) (Phƣơng pháp ống nghiệm)
 
 I. NGUYÊN LÝ
Nguyên lý của nghiệm pháp Coombs trực tiếp (Nghiệm pháp kháng globulin trực tiếp) là sử dụng thuốc thử kháng g globulin người (huyết thanh Coombs) để xác định sự có mặt của các kháng thể miễn dịch (Bao gồm các kháng thể và thành phần bổ thể là globulin) đã cảm nhiễm trên bề mặt hồng cầu người bệnh [1].
II. CHỈ ĐỊNH
- Thiếu máu tan máu tự miễn, bệnh hệ thống;
- Bệnh tan máu ở trẻ sơ sinh do bất đồng nhóm máu mẹ con;
- Phản ứng tan máu do truyền máu không hòa hợp nhóm máu giữa người cho và
người nhận.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, kỹ thuật viên, điều dưỡng.
 
2. Phƣơng tiện – Hóa chất
2.1 Phƣơng tiện
 
2.1. Trang thiết bị
Máy ly tâm loại thông thường; Kính hiển vi, Bình cách thủy, tủ lạnh.
 
2.2. Dụng cụ:
Ống nghiệm thuỷ tinh: 12x75mm; Giá cắm ống nghiệm; Khay men hình chữ
nhật: 25x30 cm; Cốc thuỷ tinh có mỏ loại 500 ml; Bút marker; Pipet nhựa.
 
2.3 Vật tư tiêu hao
Sổ ghi kết quả; Phiếu xét nghiệm; Mũ giấy; Khẩu trang; Găng tay; Quần áo công tác.
2.2. Thuốc thử và hoá chất
Nước muối sinh lý 0,9%; Nước cất, Hồng cầu chứng; Kháng g globulin người;
 
dung dịch LISS.
 
3. Mẫu bệnh phẩm

1 ống máu chống đông (bằng EDTA) của người bệnh: 2 ml.
4. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị đầy đủ dụng cụ, hoá chất, sinh phẩm trước khi tiến hành xét nghiệm.
2. Nhận bệnh phẩm và phiếu yêu cầu xét nghiệm của lâm sàng, kiểm tra và
đối chiếu các thông tin của người bệnh trên ống máu và phiếu xét nghiệm.
 
3. Tiến hành kỹ thuật [2]
- Bước 1:   Chuẩn bị một ống nghiệm sạch, khô và ghi nhãn họ và tên hoặc mã số của người bệnh; Nhỏ 0,5 ml hồng cầu khối của người bệnh vào ống nghiệm, rửa 3 lần bằng nước muối sinh lý 0,9%.
- Bước 2:  Chuẩn bị dung dịch hồng cầu 5% (1giọt hồng cầu khối của người bệnh và 19 giọt nước muối sinh lý 0,9%, trộn đều); Kiểm tra hồng cầu xem có hiện tượng tự ngưng kết không?
- Bước 3:  Nhỏ 1 giọt hồng cầu 5% của người bệnh vào ống nghiệm đã
ghi nhãn ở trên;
- Bước 4:  Thêm 2 giọt huyết thanh Coombs vào ống nghiệm trên, trộn đều.
- Bước 5:  Ly tâm 1000 vòng trong 20 giây;
- Bước 6: Với những ống nghiệm cho kết quả âm tính nhỏ 1 giọt hồng cầu chứng, ly tâm 1000 vòng/phút x 15-30 giây. Đọc và ghi lại kết quả vào phiếu xét nghiệm. Phản ứng phải cho kết quả ngưng kết từ 2+ đến 3+. Nếu những ống nghiệm sau khi nhỏ hồng cầu chứng mà không ngưng kết thì phải lặp lại xét nghiệm từ đầu.
VI. NHẬN ĐỊNH KẾT QUẢ
- Nghiệm pháp Coombs trực tiếp âm tính: Không có kháng thể miễn dịch, tự
miễn trên bề mặt hồng cầu.
- Nghiệm pháp Coombs trực tiếp dương tính: Có kháng thể miễn dịch, tự miễn trên bề mặt hồng cầu.
Những điểm cần chú ý khi làm xét nghiệm
- Thực hiện kiểm chứng theo quy định của thông tư 26/ 2013/TT- BYT về
“Hướng dẫn hoạt động truyền máu” [3];
- Đọc kỹ và tuân thủ đúng các bước tiến hành kỹ thuật theo hướng dẫn của nhà sản xuất sinh phẩm mà hiện đang được sử dụng;
- Thực hiện xét nghiệm Coombs trực tiếp sớm sau khi lấy mẫu máu;
- Nếu kết quả đọc bằng mắt thường không rõ ràng cần đọc dưới kính hiển vi ánh
sáng thường.
 Tài liệu tham khảo
1.          Denise M Harmening (1999) Modern blood banking and transfusion practices, fifth edition, Book Promotion & Service Co., LTD.
2.          Máu và các sản phẩm máu an toàn, quyển 3 Huyết thanh học nhóm máu, Tài liệu dịch, năm 2011.
3.         Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về
Hướng dẫn hoạt động truyền máu.
I. NGUYÊN LÝ

NGHIỆM PHÁP COOMBS GIÁN TIẾP (Phƣơng pháp ống nghiệm) (Indirect antiglobulin test)

Nguyên lý của nghiệm pháp Coombs gián tiếp (Nghiệm pháp kháng globulin gián tiếp) là sử dụng huyết thanh kháng g globulin người (huyết thanh Coombs) để xác định sự có mặt của các kháng thể miễn dịch (Bao gồm các kháng thể hoặc thành phần bổ thể là globulin) có tự do trong huyết thanh của người bệnh [1].
II. CHỈ ĐỊNH
- Thiếu máu tan máu tự miễn, bệnh hệ thống;
- Xét nghiệm hòa hợp có sử dụng kháng globulin người;
- Sàng lọc kháng thể bất thường;
- Định danh kháng thể bất thường;
- Bệnh tan máu ở trẻ sơ sinh do bất đồng nhóm máu mẹ con;
- Định nhóm kháng nguyên của các hệ nhóm máu hồng cầu.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
 
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao để làm nghiệm pháp Coombs trực tiếp;
2.2. Thuốc thử và hoá chất
Nước muối sinh lý 0,9%; Nước cất, Hồng cầu nhóm O để cảm nhiễm; Hồng cầu chứng; Thuốc thử kháng globulin; dung dịch LISS.
2.3. Mẫu bệnh phẩm:
- Ống máu chống đông bằng EDTA: 2 ml.
- Ống máu không chống đông: 5 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm trước khi tiến hành xét nghiệm.

2. Nhận bệnh phẩm và phiếu yêu cầu xét nghiệm của lâm sàng, kiểm tra và
đối chiếu các thông tin của người bệnh trên ống máu và phiếu xét nghiệm.
 
3. Tiến hành kỹ thuật [2]
- Bước 1:   Chuẩn bị một ống nghiệm sạch, khô và ghi nhãn họ và tên hoặc mã số của người bệnh;
- Bước 2:  Chuẩn bị dung dịch hồng cầu nhóm O, 3%  (Nhỏ 1 giọt hồng cầu khối nhóm O và 29 giọt nước muối sinh lý 0,9% vào một ống nghiệm, trộn
đều);
 
- Bước 3:   Nhỏ 3 giọt huyết thanh của người bệnh vào ống nghiệm đã được ghi nhãn ở bước 1;
- Bước 4:  Thêm 1 giọt hồng cầu nhóm O, 3% vào ống nghiệm trên và trộn đều;
- Bước 5:  Thêm 3 giọt đệm LISS vào ống nghiệm trên, trộn đều;
- Bước 6:  Ủ ống nghiệm trên ở 37°C, trong vòng 15 phút;
 - Bước 7:  Sau khi ủ quan sát hiện tượng tan máu và ngưng kết. Nếu có hiện tượng tan máu và ngưng kết, ghi kết quả là dương tính.
- Bước 8:  Nếu không có hiện tượng tan máu và ngưng kết, rửa hồng cầu
4 lần bằng nước muối sinh lý 0,9%;
- Bước 9:  Thêm 2 giọt thuốc thử kháng globulin vào ống nghiệm trên, trộn đều.
- Bước 10:  Ly tâm 1000 vòng trong 20 giây;
- Bước 11: Với những ống nghiệm cho kết quả âm tính, nhỏ thêm 1 giọt hồng cầu chứng, trộn đều, ly tâm 1000 vòng trong 20 giây. Đọc và ghi lại kết quả vào phiếu xét nghiệm. Phản ứng phải cho kết quả ngưng kết từ 2+ đến 3+. Nếu những ống nghiệm sau khi nhỏ hồng cầu chứng mà không ngưng kết thì phải lặp lại xét nghiệm từ đầu.
VI. NHẬN ĐỊNH KẾT QUẢ
- Kết quả nghiệm pháp Coombs gián tiếp âm tính:  Không có kháng thể miễn dịch trong huyết thanh của người bệnh và người hiến máu, trên hồng cầu không có kháng nguyên tương ứng với kháng thể nhóm máu được xác định.
- Kết quả nghiệm pháp Coombs gián tiếp dương tính:  Có kháng thể miễn dịch trong huyết thanh của người bệnh và người hiến máu, trên hồng cầu có kháng nguyên tương ứng với kháng thể nhóm máu được xác định.
Những điểm cần chú ý khi làm xét nghiệm
Giống như những điểm cần chú ý khi làm nghiệm pháp Coombs trực tiếp.
 Tài liệu tham khảo
1.  Denise  M  Harmening  (1999)  Modern  blood  banking  and  transfusion practices, fifth edition, Book Promotion & Service Co., LTD.
2.  Máu và các sản phẩm máu an toàn, quyển 3 Huyết thanh học nhóm máu, Tài liệu dịch, năm 2011.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

ĐNH NHÓM MÁU HỆ Rh (D) yếu
(Phƣơng pháp ống nghiệm) Determination of Du antigen of Rh system
 
I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên D yếu của hệ Rh được dựa trên nguyên lý của phản ứng ngưng kết và sử dụng thuốc thử kháng globulin người (huyết thanh Coombs) để xác định sự có mặt của các kháng thể D loại IgG đã được cảm nhiễm trên bề mặt hồng cầu [1].
II. CHỈ ĐỊNH 
Xác định kháng nguyên D yếu của hệ Rh được chỉ định trong những trường hợp sau:
- Xác định kháng nguyên D yếu của hệ Rh cho người bệnh;
- Xác định kháng nguyên D yếu của hệ Rh cho người hiến máu;
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
 
2.1. Trang thiết bị
Máy ly tâm thường có số vòng chính xác; Kính hiển vi; Bình cách thủy; Tủ
lạnh.
 
2.2. Dụng cụ
Ống nghiệm thuỷ tinh: 12x75mm; Giá cắm ống nghiệm; Khay men hình chữ
nhật: 25x30 cm; Cốc thuỷ tinh có mỏ loại 500 ml; Bút marker; Pipet nhựa.
 
2.3. Thuốc thử và hoá chất
Thuốc thử Anti D loại IgG, Nước muối sinh lý 0,9%; Nước cất.
 
2.4. Mẫu máu để xác định kháng nguyên D yếu của hệ Rh
Một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
 
2.5. Vật  tư tiêu hao
Sổ ghi kết quả; Phiếu xét nghiệm định nhóm máu; Mũ giấy; Khẩu trang; Găng
tay; Quần áo công tác.
3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm trước khi tiến hành xét nghiệm.
 
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên D yếu của hệ nhóm máu máu Rh, kiểm tra và đối chiếu các thông tin trên ống máu và phiếu xét nghiệm xem đã phù hợp chưa?
3. Chuẩn bị hồng cầu cần xác định kháng nguyên D yếu của hệ Rh 3%
(1giọt hồng cầu khối và 29 giọt nước muối sinh lý 0,9%).
4. Chuẩn bị 1 ống nghiệm sạch, khô ghi nhãn bao gồm các thông tin của
người cần xác định kháng nguyên D yếu lên ống nghiệm.
 
5. Tiến hành xác định kháng nguyên D yếu của hệ nhóm máu Rh [2]:
- Bước 1: Nhỏ 1 giọt dung dịch hồng cầu 3% của người cần xác định kháng nguyên D yếu vào ống nghiệm đã ghi nhãn ở trên;
- Bước 2: Thêm 2 giọt thuốc thử anti D loại IgG vào ống nghiệm trên, trộn đều;
- Bước 3: Ủ ống nghiệm trên 30 phút ở 37oC (Nếu thêm 2 giọt dung dịch LISS
vào ống nghiệm trên trước khi ủ thì chỉ cần ủ 15 phút).
- Bước 4:  Quan sát hiện tượng tan máu và ngưng kết, ghi lại mức độ ngưng kết.
- Bước 5: Nếu không ngưng kết, rửa 4 lần bằng nước muối sinh lý 0,9%;
- Bước 6: Thêm 2 giọt thuốc thử kháng globulin vào ống nghiệm trên và trộn
đều. Ly tâm 1000 vòng trong 20 giây.
- Bước 7: Quan sát hiện tượng tan máu và ngưng kết, ghi lại kết quả.
- Bước 8: Nếu phản ứng ngưng kết, thực hiện thêm nghiệm pháp Coombs trực tiếp; nếu nghiệm pháp Coombs trực tiếp âm tính thì kết luận là hồng cầu mang kháng nguyên D yếu.
- Bước 9: Nếu phản ứng không ngưng kết thì thêm 1 giọt hồng cầu chứng, trộn đều, ly tâm 1000 vòng trong 20 giây. Kết quả phải ngưng kết với mức độ từ 1+ đến 2+ thì xét nghiệm mới có giá trị.
VI. NHẬN ĐỊNH KẾT QUẢ
- Nếu phản ứng ngưng kết ở giai đoạn 37oC và/ hoặc kháng globulin: Kết luận hồng cầu mang kháng nguyên D yếu.
- Nếu phản ứng không ngưng kết cả ở giai đoạn 37oC và/ hoặc kháng globulin
người: Kết luận người bệnh hoặc người hiến máu có nhóm máu Rh D âm.
 Những điểm cần chú ý khi làm xét nghiệm:
- Thực hiện kiểm chứng theo quy định của thông tư 26/ 2013/TT- BYT về
Hướng dẫn hoạt động truyền máu [3].
- Hướng dẫn sử dụng anti DVI loại IgG để xác định D yếu.
 Tài liệu tham khảo
1.  Denise  M  Harmening  (1999)  Modern  blood  banking and  transfusion practices, fifth edition, Book Promotion & Service Co., LTD.
2.  Máu và các sản phẩm máu an toàn, quyển 3 Huyết thanh học nhóm máu, Tài liệu dịch, năm 2011.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

XÁC ĐỊNH KHÁNG NGUYÊN C CỦA HỆ NHÓM MÁU Rh
(Kỹ thuật ống nghiệm) Determination C antigen of Rh system
 
 
I.  NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên C của hệ nhóm máu Rh được dựa trên nguyên lý của phản ứng ngưng kết. Anti C loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên C [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên C của hệ Rh được chỉ định trong những trường hợp sau:
- Xét nghiệm cho người bệnh;
- Xét nghiệm cho người hiến máu; Xét nghiệm để xây dựng panel hồng cầu, lực lượng hiến máu dự bị và xây dựng ngân hàng người hiến máu có nhóm máu hiếm.
- Xét nghiệm cho các nghiên cứu về hằng số và nhân chủng học.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị
Kính hiển vi; Bình cách thủy; Tủ lạnh. Máy ly tâm thường có số vòng chính xác;
2.2. Dụng cụ
Ống nghiệm thuỷ tinh: 12x75mm; Giá cắm ống nghiệm; Khay men hình chữ
nhật: 25x30 cm; Cốc thuỷ tinh có mỏ loại 500 ml; Bút marker; Pipet nhựa.
 
2.3. Thuốc thử và hoá chất
Thuốc thử anti C loại IgM; Nước muối sinh lý 0,9%; Nước cất…
 
2.4. Mẫu máu để xác định kháng nguyên C của hệ Rh
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
 
2.5. Vật  tư tiêu hao

Sổ ghi kết quả; Phiếu xét nghiệm định nhóm máu; Mũ giấy; Khẩu trang; Găng
tay; Quần áo công tác.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị đầy dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên C.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên C: Kiểm tra và đối chiếu các thông tin trên mẫu máu với phiếu yêu cầu xét nghiệm; Kiểm tra về số lượng và chất lượng mẫu máu.
3. Tiến hành xác định kháng nguyên C của hệ nhóm máu Rh [2]
- Bước 1: Chuẩn bị hồng cầu cần xác định kháng nguyên C 5% (1thể tích hồng cầu khối và 19 thể tích NaCl 0,9%);
- Bước 2: Nhỏ 1 giọt thuốc thử anti C loại IgM vào ống nghiệm đã chuẩn bị ở
trên;
- Bước 3: Thêm 1 giọt hồng cầu 5% của người cần xác định kháng nguyên C
vào ống nghiệm trên;
- Bước 4: Trộn đều, ly tâm 1000 vòng trong 20 giây.
- Bước 5:  Đọc kết quả và ghi lại mức độ ngưng kết.
 
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên C trên hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên C trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
- Thực hiện kiểm chứng theo quy định của thông tư 26/ 2013/TT- BYT về
Hướng dẫn hoạt động truyền máu [3].
- Hướng dẫn sử dụng anti C loại IgM.
- Thực hiện kỹ thuật xác định kháng nguyên C sớm sau khi lấy mẫu máu.
 Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti C loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về
Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN c CỦA HỆ NHÓM MÁU Rh (Kỹ thuật ống nghiệm) Determination c antigen of Rh system
 
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên c của hệ nhóm máu Rh được dựa trên nguyên lý của phản ứng ngưng kết. Anti c loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên c [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên c của hệ Rh: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao để xác định kháng nguyên C
của hệ Rh.
 
2.2. Thuốc thử và hoá chất:
Thuốc thử anti c loại IgM; Nước muối sinh lý 0,9%; Nước cất…
 
2.3. Mẫu máu để xác định kháng nguyên c của hệ Rh
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị đầy dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên c.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên c, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên c với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên c của hệ nhóm máu Rh[2]: Được thực hiện theo hướng dẫn sử dụng anti c loại IgM, các bước tiến hành tương tự với các bước xác định kháng nguyên C của hệ Rh.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên c trên hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên c trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 
Tài liệ u tham khả o
1.  Geoff  Daniels  and  Imelda  Bromilow  (2009),  Essential  Guide  to  Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti c loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN E CỦA HỆ NHÓM MÁU Rh
(Kỹ thuật ống nghiệm) Determination E antigen of Rh system
 
 
I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên E của hệ nhóm máu Rh được dựa trên nguyên lý của phản ứng ngưng kết. Anti E loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên E [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên E của hệ Rh: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất
Thuốc thử anti E loại IgM; Nước muối sinh lý 0,9%; Nước cất…
 
2.3. Mẫu máu để xác định kháng nguyên E của hệ Rh
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên E.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên E, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên E với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.
3. Tiến hành xác định kháng nguyên E của hệ nhóm máu Rh

Được thực hiện theo hướng dẫn sử dụng anti E loại IgM, các bước tiến hành
tương tự với các bước xác định kháng nguyên C của hệ Rh
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên E trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên E trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 
 Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng Anti E loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN e CỦA HỆ NHÓM MÁU Rh
(Kỹ thuật ống nghiệm) Determination e antigen of Rh system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên e của hệ nhóm máu Rh được dựa trên nguyên lý của phản ứng ngưng kết. Anti e loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên e [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên e của hệ Rh: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện- Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất
Thuốc thử anti e loại IgM; Nước muối sinh lý 0,9%; Nước cất…
 
2.3. Mẫu máu để xác định kháng nguyên e của hệ Rh
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên e.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên e, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên e với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.
3. Tiến hành xác định kháng nguyên e của hệ nhóm máu Rh [2]

Được thực hiện theo hướng dẫn sử dụng anti e loại IgM, các bước tiến hành
tương tự với các bước xác định kháng nguyên C của hệ Rh.
 
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên e trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên e trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti e loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN K CỦA HỆ NHÓM MÁU KELL
(Kỹ thuật ống nghiệm) Determination K antigen of Kell system 
I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên K của hệ nhóm máu Kell được dựa trên nguyên lý của phản ứng ngưng kết. Anti K loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên K [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên K của hệ Kell: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất
Thuốc thử anti K loại IgM; Nước muối sinh lý 0,9%; Nước cất…
 
2.3. Mẫu máu để xác định kháng nguyên K của hệ Kell
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên K.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên K, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên K với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.
3. Tiến hành xác định kháng nguyên K của hệ nhóm máu Kell [2]

Được thực hiện theo hướng dẫn sử dụng anti K loại IgM, các bước tiến hành
tương tự với các bước xác định kháng nguyên C của hệ Rh.
 
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên K trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên K trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh. 
Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti K loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN k CỦA HỆ NHÓM MÁU KELL
(Kỹ thuật ống nghiệm) Determination k antigen of Kell system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên k của hệ nhóm máu Kell được dựa trên nguyên lý của phản ứng ngưng kết. Anti k loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên k [1].
II. CHỈ ĐỊNH
Xác định kháng nguyên k của hệ Kell: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất
Thuốc thử anti k loại IgM; Nước muối sinh lý 0,9%; Nước cất…
 
2.3. Mẫu máu để xác định kháng nguyên k của hệ Kell
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên k.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên k, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên k với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên k của hệ nhóm máu Kell [2]: Được thực hiện theo hướng dẫn sử dụng anti k loại IgM, các bước tiến hành tương tự với các bước xác định kháng nguyên C của hệ Rh.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên k trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên k trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.

Tài liệ u tham khả o
1. Geoff  Daniels  and  Imelda  Bromilow  (2009),  Essential  Guide  to  Blood
Groups, Blackwell.
2. Hướng dẫn sử dụng anti k loại IgM.
3. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

XÁC ĐỊNH KHÁNG NGUYÊN Jka CA HỆ NHÓM MÁU KIDD (Kỹ thuật ống nghiệm)
Determination Jka antigen of Kidd system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên Jka của hệ nhóm máu Kidd được dựa trên nguyên lý của phản ứng ngưng kết. Anti Jka loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên Jka [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên Jka  của hệ Kidd:  Được chỉ định giống như chỉ định
xác định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất
Thuốc thử anti Jka loại IgM; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên Jka của hệ Kidd
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Jka.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Jka, kiểm tra và
đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Jka với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.
3. Tiến hành xác định kháng nguyên Jka của hệ nhóm máu Kidd [2]

Được thực hiện theo hướng dẫn sử dụng anti Jka  loại IgM, các bước tiến hành
tương tự với các bước xác định kháng nguyên C của hệ Rh.
 
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên Jka trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên Jka trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti Jka loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN Jkb CỦA HỆ NHÓM MÁU KIDD (Kỹ thuật ống nghiệm)
Determination Jkb antigen of Kidd system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên Jkb của hệ nhóm máu Kidd được dựa trên nguyên lý của phản ứng ngưng kết. Anti Jkb loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên Jkb [1], 2].
II. CHỈ ĐỊNH
Xác định kháng nguyên Jkb  của hệ Kidd: Được chỉ định giống như chỉ định
xác định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất
Thuốc thử anti Jkb loại IgM; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên Jkb của hệ Kidd
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Jkb.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Jkb, kiểm tra và
đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Jkb với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.
3. Tiến hành xác định kháng nguyên Jkb của hệ nhóm máu Kidd [2]
Được thực hiện theo hướng dẫn sử dụng anti Jkb  loại IgM, các bước tiến hành
tương tự với các bước xác định kháng nguyên C của hệ Rh.
 
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên Jkb trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên Jkb trên hồng cầu.
 Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh. 
Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti JKb loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN S CỦA HỆ NHÓM MÁU MNS (Kỹ thuật ống nghiệm)
Determination S antigen of MNS system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên S của hệ nhóm máu MNS được dựa trên nguyên lý của phản ứng ngưng kết. Anti S loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên S [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên S của hệ MNS: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất
Thuốc thử anti S loại IgM; Nước muối sinh lý 0,9%; Nước cất…
 
2.3. Mẫu máu để xác định kháng nguyên S của hệ MNS
Gồm một ống máu tĩnh đã mạch được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên S.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên S, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên S với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.
3. Tiến hành xác định kháng nguyên S của hệ nhóm máu MNS [2]

Được thực hiện theo hướng dẫn sử dụng anti S loại IgM, các bước tiến hành tương tự với các bước xác định kháng nguyên C của hệ Rh.
 
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên S trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên S trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C của hệ Rh.
 
Tài liệ u tham khả o
1. Geoff  Daniels  and  Imelda  Bromilow  (2009),  Essential  Guide  to  Blood
Groups, Blackwell.
2. Hướng dẫn sử dụng anti S loại IgM.
3. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN P1 CỦA HỆ P1PK (kỹ thuật ống nghiệm)
Determination P1 antigen of P1PK system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên P1 của hệ nhóm máu P1PK được dựa trên nguyên lý của phản ứng ngưng kết. Anti P1 loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên P1 [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên P1 của hệ P1PK:  Được chỉ định giống như chỉ định
xác định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti P1 loại IgM; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên P1 của hệ P1PK:
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên P1.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên P1, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên P1 với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên P1 của hệ nhóm máu P1PK [2]: Được thực hiện theo hướng dẫn sử dụng anti P1 loại IgM, các bước tiến hành tương tự với các bước xác định kháng nguyên C của hệ Rh.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên P1 trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên P1 trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti P1 loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN Lea CỦA HỆ NHÓM MÁU LEWIS (Phƣơng pháp ống nghiệm)
Determination Lea antigen of Lewis system
 
I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên Lea  của hệ nhóm máu Lewis được dựa trên nguyên lý của phản ứng ngưng kết. Anti Lea loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên Lea [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên Lea  của hệ Lewis: Được chỉ định giống như chỉ định
xác định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti Lea loại IgM; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên Lea của hệ Lewis:
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Lea.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Lea, kiểm tra và
đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Lea với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên Lea của hệ nhóm máu Lewis [2]: Được thực hiện theo hướng dẫn sử dụng anti Lea loại IgM, các bước tiến hành tương tự với các bước xác định kháng nguyên C của hệ Rh.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên Lea trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên Lea trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 
Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti Lea loại IgM.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN Leb CA HỆ NHÓM MÁU LEWIS (Kỹ thuật ống nghiệm)
Determination Leb antigen of Lewis system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên Leb  của hệ nhóm máu Lewis được dựa trên nguyên lý của phản ứng ngưng kết. Anti Leb loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên Leb [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên Leb  ca hệ Lewis Được chỉ định giống như chỉ định
xác định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti Leb loại IgM; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên Leb của hệ Lewis:
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Leb.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Leb, kiểm tra và
đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Leb với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên Leb của hệ nhóm máu Lewis [2]: Được thực hiện theo hướng dẫn sử dụng anti Leb  loại IgM, các bước tiến hành tương tự với các bước xác định kháng nguyên C của hệ Rh.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên Leb trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên Leb trên hồng cầu.
 Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 Tài liệu tham khảo
1. Geoff  Daniels  and  Imelda Bromilow  (2009),  Essential  Guide  to  Blood
Groups, Blackwell.
2. Hướng dẫn sử dụng anti Leb loại IgM.
3. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN Kpa CA HỆ NHÓM MÁU KELL (Kỹ thuật ống nghiệm)
Determination Kpa antigen of Kell system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên Kpa của hệ nhóm máu Kell được dựa trên nguyên lý của phản ứng ngưng kết, sử dụng thuốc thử kháng g globulin người để xác định sự có mặt của các kháng thể Kpa loại IgG đã được cảm nhiễm trên bề mặt hồng cầu của những cá thể mang kháng nguyên Kpa [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên Kpa  của hệ Kell:  Được chỉ định giống như chỉ định
xác định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti Kpa loại IgG; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên Kpa ca hệ Kell:
Gồm một ống máu tĩnh đã mạch được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Kpa.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Kpa, kiểm tra và
đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Kpa với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên Kpa của hệ nhóm máu Kell:
- Bước 1: Chuẩn bị hồng cầu cần xác định kháng nguyên Kpa  5% (1thể tích hồng cầu khối và 19 thể tích nước muối sinh lý 0,9%);
- Bước 2: Nhỏ 1 giọt thuốc thử anti Kpa vào ống nghiệm đã chuẩn bị ở trên;
- Bước 3: Thêm 1 giọt hồng cầu 5% của người cần xác định kháng nguyên Kpb
vào ống nghiệm trên;
- Bước 4: Ủ từ 15 - 20 phút ở nhiệt độ 37oC.
- Bước 5: Trộn đều, ly tâm 1000 vòng trong 20 giây.
- Bước 6:  Đọc kết quả và ghi lại mức độ ngưng kết.
- Bước 7: Rửa 3 lần bằng nước muối sinh lý 0,9%, loại bỏ hết dịch nổi.
- Bước 8: Nhỏ vào ống nghiệm trên 2 giọt kháng globulin.
- Bước 9: Trộn đều, ly tâm 1000 vòng trong 20 giây.
- Bước 10: Đọc kết quả và ghi lại mức độ phản ứng, nếu phản ứng không ngưng kết, nhỏ thêm một giọt hồng cầu chứng và lặp lại bước 5 và 6.  Nếu kết quả vẫn không ngưng kết là không có giá trị và phải lặp lại xét nghiệm.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên Kpa trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên Kpa trên hồng cầu.
 Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh. 
Tài liệu tham khảo
1.  Denise  M  Harmening  (1999)  Modern  blood  banking and  transfusion practices, fourth edition, Book Promotion & Service Co., LTD.
2.  Hướng dẫn sử dụng anti Kpa  loại IgG.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN Kpb CA HỆ NHÓM MÁU KELL (Kỹ thuật ống nghiệm)
Determination Kpb antigen of Kell system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên Kpb của hệ nhóm máu Kell được dựa trên nguyên lý của phản ứng ngưng kết, sử dụng thuốc thử kháng g globulin người để xác định sự có mặt của các kháng thể Kpb loại IgG đã được cảm nhiễm trên bề mặt hồng cầu của những cá thể mang kháng nguyên Kpb [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên Kpb của hệ Kell: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện:
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất:
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti Kpb loại IgG; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên Kpb ca hệ Kell:
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Kpb.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Kpb, kiểm tra và
đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Kpb với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên Kpb của hệ nhóm máu Kell [2]: Được thực hiện theo hướng dẫn sử dụng anti Kpb  loại IgG, các bước tiến hành tương tự với các bước xác định kháng nguyên Kpa của hệ Kell.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên Kpb trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên Kpb trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 Tài liệ u tham khả o
1.  Denise  M  Harmening  (1999)  Modern  blood  banking and  transfusion practices, fourth edition, Book Promotion & Service Co., LTD.
2.  Hướng dẫn sử dụng anti Kpb loại IgG.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN M CỦA HỆ NHÓM MÁU MNS (Kỹ thuật ống nghiệm)
Determination M antigen of MNS system
 
I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên M của hệ nhóm máu MNS được dựa trên nguyên lý của phản ứng ngưng kết, sử dụng thuốc thử kháng g globulin người để xác định sự có mặt của các kháng thể M loại IgG đã được cảm nhiễm trên bề mặt hồng cầu của những cá thể mang kháng nguyên M [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên M của hệ MNS: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện:
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti M loại IgG; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên M của hệ MNS:
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên M.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên M, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên M với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên M của hệ nhóm máu MNS [2]: Được thực hiện theo hướng dẫn sử dụng anti M loại IgG, các bước tiến hành tương tự với các bước xác định kháng nguyên Kpb của hệ Kell.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên M trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên M trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti M loại IgG.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN N CỦA HỆ NHÓM MÁU MNS (Kỹ thuật ống nghiệm)
Determination N antigen of MNS system
 I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên N của hệ nhóm máu MNS được dựa trên nguyên lý của phản ứng ngưng kết, sử dụng thuốc thử kháng g globulin người để xác định sự có mặt của các kháng thể N loại IgG đã được cảm nhiễm trên bề mặt hồng cầu của những cá thể mang kháng nguyên N [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên N của hệ MNS: Được chỉ định giống như chỉ định xác
định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti N loại IgG; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên N của hệ MNS:
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên N.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên N, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên N với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên N của hệ nhóm máu MNS Được thực hiện theo hướng dẫn sử dụng anti N loại IgG, các bước tiến hành tương tự với các bước xác định kháng nguyên Kpb của hệ Kell.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên N trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên N trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 Tài liệ u tham khả o
1.  Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.
2.  Hướng dẫn sử dụng anti N loại IgG.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN Fya CA HỆ NHÓM MÁU DUFFY (Kỹ thuật ống nghiệm)
Determination Fya antigen of Duffy system
 
I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên Fya của hệ nhóm máu Duffy được dựa trên nguyên lý của phản ứng ngưng kết, sử dụng thuốc thử kháng g globulin người để xác định sự có mặt của các kháng thể Fya loại IgG đã được cảm nhiễm trên bề mặt hồng cầu của những cá thể mang kháng nguyên Fya [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên Fya  của hệ Duffy: Được chỉ định giống như chỉ định
xác định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti Fya loại IgG; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên Fya của hệ Duffy:
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Fya.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Fya, kiểm tra và
đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Fya với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên Fya của hệ nhóm máu Duffy [2]: Được thực hiện theo hướng dẫn sử dụng anti Fya loại IgG, các bước tiến hành tương tự với các bước xác định kháng nguyên Kpb của hệ Kell.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên Fya trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên Fya trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 Tài liệ u tham khả o
1.  Denise  M  Harmening  (1999)  Modern  blood  banking and  transfusion practices, fourth edition, Book Promotion & Service Co., LTD.
2.  Hướng dẫn sử dụng anti Fya  loại IgG.
3.  Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

C ĐỊNH KHÁNG NGUYÊN Fyb CỦA HỆ NHÓM MÁU DUFFY (Kỹ thuật ống nghiệm)
Determination Fyb antigen of Duffy system 
I. NGUYÊN LÝ
Kỹ thuật xác định kháng nguyên Fyb của hệ nhóm máu Duffy được dựa trên nguyên lý của phản ứng ngưng kết, sử dụng thuốc thử kháng g globulin người để xác định sự có mặt của các kháng thể Fyb  loại IgG đã được cảm nhiễm trên bề mặt hồng cầu của những cá thể mang kháng nguyên Fyb [1], [2].
II. CHỈ ĐỊNH
Xác định kháng nguyên Fyb  của hệ Duffy: Được chỉ định giống như chỉ định
xác định kháng nguyên C của hệ Rh.
 
III. CHỐNG CHỈ ĐỊNH Không có chống chỉ định. IV. CHUẨN BỊ
1. Ngƣời thực hiện
Bác sĩ, cử nhân, kỹ thuật viên, điều dưỡng trung học.
 
2. Phƣơng tiện – Hóa chất
2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:
Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh.
2.2. Thuốc thử và hoá chất:
Thuốc thử anti Fyb loại IgG; Nước muối sinh lý 0,9%; Nước cất…
2.3. Mẫu máu để xác định kháng nguyên Fyb của hệ Duffy:
Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.
3. Thời gian làm xét nghiệm: 60 phút
 
V. CÁC BƢỚC TIẾN HÀNH
1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Fyb.
2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Fyb, kiểm tra và
đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Fyb với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên Fyb của hệ nhóm máu Duffy [2]: Được thực hiện theo hướng dẫn sử dụng anti Fyb loại IgG, các bước tiến hành tương tự với các bước xác định kháng nguyên Kpb của hệ Kell.
VI. NHẬN ĐỊNH KẾT QUẢ
- Phản ứng ngưng kết: Có kháng nguyên Fyb trên bề mặt hồng cầu.
- Phản ứng không ngưng kết: Không có kháng nguyên Fyb trên hồng cầu.
 
Những điểm cần chú ý khi làm xét nghiệm:
Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C
của hệ Rh.
 
 Tài liệ u tham khả o
1. Denise  M  Harmening  (1999)  Modern  blood  banking  and  transfusion practices, fourth edition, Book Promotion & Service Co., LTD.
2. Hướng dẫn sử dụng anti Fyb loại IgG.
3. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.